After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CSRP1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004078.2
Tamanho de cDNA:582bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cysteine and glycine-rich protein 1.
Sinónimo de gene:CRP, CRP1, CSRP, CYRP, D1S181E, DKFZp686M148, CSRP1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-CSRP1
Local de restrição:HindIII + XbaI (6.1kb + 0.58kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human CSRP1 Gene Plasmid Map
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11201-ACG$225
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11201-ACR$225
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11201-ANG$225
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11201-ANR$225
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11201-CF$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11201-CH$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11201-CM$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11201-CY$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11201-M$75
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11201-M-F$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11201-NF$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11201-NH$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11201-NM$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11201-NY$195
Humano CSRP1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11201-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Mouse Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

Referências
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Size / Price
    Catálogo: HG11201-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"