After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CSNK1A1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001892.4
Tamanho de cDNA:1014bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
Sinónimo de gene:CK1, HLCDGP1, PRO2975, CSNK1A1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
Local de restrição:KpnI + XbaI (6.1kb + 1.01kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10668-ACG$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10668-ACR$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10668-ANG$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10668-ANR$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10668-CF$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10668-CH$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10668-CM$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10668-CY$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10668-M$75
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10668-M-F$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10668-NF$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10668-NH$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10668-NM$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10668-NY$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10668-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

Referências
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Catálogo: HG10668-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"