After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CRIPT Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC006980
Tamanho de cDNA:306bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal Flag tag.
Sinónimo de gene:HSPC139
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14560-ACG$225
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14560-ACR$225
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14560-ANG$225
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14560-ANR$225
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14560-CF$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14560-CH$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14560-CM$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14560-CY$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de expressão)HG14560-G$75
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14560-NF$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14560-NH$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14560-NM$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14560-NY$195
Humano CRIPT / cysteine-rich PDZ-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14560-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

Referências
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Catálogo: HG14560-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"