Encomenda rápida

Text Size:AAA

Humano CRELD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CRELD1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1263bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cysteine-rich with EGF-like domains 1 with C terminal His tag.
Sinónimo de gene:AVSD2, CIRRIN, CRELD1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.

  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Size / Price
    Catálogo: HG13411-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.