After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Human COMMD9 ORF mammalian expression plasmid, N-Flag tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human COMMD9 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:597bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens COMM domain containing 9 with N terminal Flag tag.
Sinónimo de gene:HSPC166
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

  • Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.