Encomenda rápida

Text Size:AAA

Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human COL4A3BP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1797bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen) binding protein with N terminal Myc tag.
Sinónimo de gene:CERT, CERTL, FLJ20597, GPBP, STARD11, COL4A3BP
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14306-ACG$245
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14306-ACR$245
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14306-ANG$245
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14306-ANR$245
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14306-CF$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14306-CH$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14306-CM$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14306-CY$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de expressão)HG14306-G$75
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14306-NF$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14306-NH$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14306-NM$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14306-NY$215
Humano COL4A3BP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14306-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its amino terminus and a START domain towards the end of the molecule. COL4A3BP has a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. One isoform of COL4A3BP is also involved in ceramide intracellular transport. COL4A3BP specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. An autoimmune response directed at this antigen can cause goodpasture disease.

  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Granero F, et al. (2005) A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein. FEBS J. 272(20):5291-305.
  • Longo I, et al. (2006) Autosomal recessive Alport syndrome: an in-depth clinical and molecular analysis of five families. Nephrol Dial Transplant. 21(3):665-71.
  • Size / Price
    Catálogo: HG14306-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.