Encomenda rápida

Humano ASAM / CLMP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CLMP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1122bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens adipocyte-specific adhesion molecule with N terminal Myc tag.
Sinónimo de gene:ASAM, ACAM, CLMP, FLJ22415
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano ASAM / CLMP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.

  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • Size / Price
    Catálogo: HG10794-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.