After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CIRBP Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC000403
Tamanho de cDNA:519bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cold inducible RNA binding protein with N terminal Flag tag.
Sinónimo de gene:CIRP
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14578-ACG$225
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14578-ACR$225
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14578-ANG$225
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14578-ANR$225
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14578-CF$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14578-CH$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14578-CM$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14578-CY$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de expressão)HG14578-G$75
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14578-NF$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14578-NH$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14578-NM$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14578-NY$195
Humano CIRBP / Cold-inducible RNA-binding Proteína clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14578-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

Referências
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • Size / Price
    Catálogo: HG14578-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"