Encomenda rápida

Humano YKL-39/CHI3L2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano CHI3L2 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1173bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens chitinase 3-like 2 with C terminal Myc tag.
    Sinónimo de gene:YKL39, YKL-39, CHI3L2
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with CHI3L2 qPCR primers for gene expression analysis, HP101796 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name

    Chondrocyte protein 39 (YKL-39), also known as Chitinase 3-like 2 (CHI3L2), is a secretory protein of articular chondrocytes belonging to the glycosyl hydrolase 18 family. It highest expression is in chondrocytes, followed by synoviocytes, lung and heart. YKL-39/CHI3L2 is not detected in spleen, pancreas, and liver. YKL-39/CHI3L2 may also be expressed in developing brain and placenta. YKL-39/CHI3L2, a cartilage-related protein, is found to induce arthritis accompanied by pathologic changes in bone and cartilage. A better understanding of the immune response against cartilage-related components including YKL-39 may help to elucidate the pathological processes of arthritic disorders. Up regulation of YKL-39/CHI3L2 in osteoarthritic cartilage suggests that YKL-39/CHI3L2 may be a more accurate marker of chondrocyte activation than YKL-40, although it has yet to be established as a suitable marker in synovial fluid and serum. The decreased expression of YKL-40 by osteoarthritic chondrocytes is surprising as increased levels have been reported in rheumatoid and osteoarthritic synovial fluid, where it may derive from activated synovial cells or osteophytic tissue or by increased matrix destruction in the osteoarthritic joint. YKL-39 and YKL-40 are potentially interesting marker molecules for arthritic joint disease because they are abundantly expressed by both normal and osteoarthritic chondrocytes.

  • Sakata M, et al. (2002) YKL-39, a human cartilage-related protein, induces arthritis in mice. Clin Exp Rheumatol. 20(3): 343-50.
  • Areshkov PA, et al. (2010) Chitinase 3-like protein 2 (CHI3L2, YKL-39) activates phosphorylation of extracellular signal-regulated kinases ERK1/ERK2 in human embryonic kidney (HEK293) and human glioblastoma (U87 MG) cells. Tsitol Genet. 44(1): 3-9.
  • Steck E, et al. (2002) Enhanced expression of the human chitinase 3-like 2 gene (YKL-39) but not chitinase 3-like 1 gene (YKL-40) in osteoarthritic cartilage. Biochem Biophys Res Commun. 299(1): 109-15.
  • Size / Price
    Catálogo: HG12162-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.