Encomenda rápida

Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CHAT Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1893bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens choline O-acetyltransferase with C terminal His tag.
Sinónimo de gene:CMS1A, CMS1A2, CHOACTASE
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15748-ACG$245
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15748-ACR$245
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15748-ANG$245
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15748-ANR$245
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15748-CF$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15748-CH$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15748-CM$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15748-CY$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de expressão)HG15748-G$75
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15748-NF$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15748-NH$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15748-NM$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15748-NY$215
Humano Choline Acetyltransferase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15748-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15748-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.