Encomenda rápida

Humano CEP70 clonagem de ADN ou de clonagem do gene (vector de clonagem)

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano CEP70 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC016050
Tamanho de cDNA:639bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens centrosomal protein 70kDA.
Sinónimo de gene:BITE, FLJ13036, CEP70
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-CEP70
Local de restrição:KpnI + XbaI(6.1kb+0.64kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CEP70 qPCR primers for gene expression analysis, HP102885 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CEP70 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"