Encomenda rápida

Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CDKN1B Informações sobre o produto de clone de cDNA
Tamanho de cDNA:597bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1) with C terminal His tag.
Sinónimo de gene:KIP1, MEN4, CDKN4, MEN1B, P27KIP1, CDKN1B
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11109-ACG$225
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11109-ACR$225
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11109-ANG$225
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11109-ANR$225
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11109-CF$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11109-CH$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11109-CM$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11109-CY$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de expressão)HG11109-M$75
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11109-NF$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11109-NH$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11109-NM$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11109-NY$195
Humano p27/Kip1/CDKN1B clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11109-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11109-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.