After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CDKL2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003948.3
Tamanho de cDNA:1482bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase).
Sinónimo de gene:P56, KKIAMRE, CDKL2
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-CDKL2
Local de restrição:HindIII + XbaI (6.1kb + 1.48kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human CDKL2 Gene Plasmid Map
Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11191-ACG$225
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11191-ACR$225
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11191-ANG$225
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11191-ANR$225
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11191-CF$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11191-CH$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11191-CM$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11191-CY$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11191-M$75
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11191-M-F$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11191-NF$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11191-NH$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11191-NM$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11191-NY$195
Humano CDKL2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11191-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is found expressed in various brain regions, including the cerebral cortex, entorinal cortex, hippocampus, amygdala, and dorsal thalamus. The high expression in these brain regions suggests that Cdkl2 may have functions in congnition and emotion processes. Cdkl2 accumulates primarily in the cytoplasm, with lower levels in the nucleus.

Referências
  • Sassa T, et al. (2003) Postnatal expression of Cdkl2 in mouse brain revealed by LacZ inserted into the Cdkl2 locus. Cell and Tissue Research. 315 (2): 147-56.
  • Rosenblatt J, et al. (1992) Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. PNAS. 89 (7): 2824-8.
  • Mironov V, et al. (1999) Cyclin-Dependent Kinases and Cell Division in Plants-The Nexus. The Plant Cell. 11 (4): 509-22.
  • Size / Price
    Catálogo: HG11191-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"