After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CDH6 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1992bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cadherin 6, type 2, K-cadherin (fetal kidney) with N terminal Myc tag.
Sinónimo de gene:CDH6, KCAD
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10150-ACG$245
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10150-ACR$245
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10150-CF$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10150-CH$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10150-CM$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10150-CY$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10150-M$75
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10150-M-F$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10150-M-N$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10150-NF$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10150-NH$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10150-NM$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10150-NY$215
Humano Cadherin-6/CDH6 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10150-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

  • Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.
  • Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.
  • Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.
  • Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.
  • Size / Price
    Catálogo: HG10150-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.