After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CD84 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003874.1
Tamanho de cDNA:987bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens CD84 molecule with N terminal His tag.
Sinónimo de gene:LY9B, hCD84, mCD84, SLAMF5, DKFZp781E2378
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10100-ACG$225
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10100-ACR$225
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10100-CF$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10100-CH$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10100-CM$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10100-CY$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10100-M$75
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10100-M-F$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10100-NF$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10100-NH$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10100-NM$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10100-NY$195
Humano CD84 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10100-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

Referências
  • Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.
  • Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.
  • Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.
  • Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.
  • Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.
  • Size / Price
    Catálogo: HG10100-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"