After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CD40/TNFRSF5 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CD40 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_152854.2
Tamanho de cDNA:612bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens CD40 molecule, TNF receptor superfamily member 5.
Sinónimo de gene: p50, Bp50, CDW40, TNFRSF5
Espécie:Human
Vetor:pCMV/hygro
Plasmid:pCMV-CD40-t2
Local de restrição:HindIII + XbaI (5.5kb + 0.61kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human CD40 Gene Plasmid Map
Human CD40 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Humano CD40/TNFRSF5 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Product nameProduct name
Fundo

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

Referências
  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.
  • Size / Price
    Catálogo: HG16492-G-N
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human CD40 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"