After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CD3e/CD3 epsilon clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CD3E Informações sobre o produto de clone de cDNA
Tamanho de cDNA:624bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens CD3e molecule, epsilon (CD3-TCR complex) with C terminal Flag tag.
Sinónimo de gene:T3E, TCRE, FLJ18683
Local de restrição:KpnI + XbaI (6kb + 0.66kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human CD3E Gene Plasmid Map
Human CD3E natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • Size / Price
    Catálogo: HG10977-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Human IFNG ORF mammalian expression plasmid, C-Flag tag
    • Human CD3E natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.