Encomenda rápida

Text Size:AAA

Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CD180 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1986bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens CD180 molecule with N terminal His tag.
Sinónimo de gene:LY64, Ly78, RP105, MGC126233, MGC126234, CD180
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11370-ACG$245
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11370-ACR$245
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11370-CF$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11370-CH$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11370-CM$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11370-CY$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11370-M$75
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11370-M-F$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11370-M-H$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11370-NF$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11370-NH$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11370-NM$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11370-NY$215
Humano CD180/RP105 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11370-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD180, also known as RP105, is a B-cell surface molecule belonging to the family of pathogen receptors, Toll-like receptors (TLR). CD180 has an extracellular leucine-rich repeats and a short cytoplasmic tail. CD180 / RP105 interact with an extracellular molecule named MD1 and then together form the cell surface receptor complex RP105 / MD1 which induces B-cell activation in humans and mice, leading to proliferation and up-regulation of a costimulatory molecule, B7.2 / CD86. CD180 / RP105 also has a role in LPS response because B cells lacking RP105 show hyporesponsiveness to LPS.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Nagai Y, et al. (2002) Requirement for MD-1 in cell surface expression of RP105/CD180 and B-cell responsiveness to lipopolysaccharide. Journal of the American society of hematology. 99(5): 1699-705.
  • Size / Price
    Catálogo: HG11370-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.