Encomenda rápida

Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FLT3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2982bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 3 with C terminal His tag.
Sinónimo de gene:FLK2, STK1, CD135, FLT3
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10445-ACG$325
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10445-ACR$325
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10445-CF$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10445-CH$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10445-CM$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10445-CY$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10445-M$75
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10445-M-F$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10445-M-H$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10445-M-N$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10445-NF$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10445-NH$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10445-NM$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10445-NY$295
Humano FLT3/CD135/FLK-2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10445-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD135, also known as FLT-3, FLK-2, is a member of the CD system. CD135 is an important cell surface marker recognized by specific sets of antibodies to identify the types of hematopoietic (blood) progenitors in the bone marrow and it function to differentiate hematopoietic stem cells, which are CD135 negative, from multipotent progenitors, which are CD135 positive. CD135 is a receptor tyrosine kinase typeⅢ for the cytokine Flt3 ligand and activat signaling through second messengers by binding to Flt3. Signaling through CD135 is important for lymphocyte development. The encoding gene CD135 is a proto-oncogene to which mutations happened will lead to cancer such as leukemia.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Bertho, et al. (2000) CD135 (Flk2 / Flt3) Expression by Human Thymocytes Delineates a Possible Role of FLT3-Ligand in T-Cell Precursor Proliferation and Differentiation. Scandinavian Journal of Immunology. 52 (1): 53-61.
  • Size / Price
    Catálogo: HG10445-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.