Encomenda rápida

Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

  • Human IL12A / IL-12A Gene Plasmid Map 5646
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano VCAM1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001078.2
Tamanho de cDNA:2241 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1 with N terminal His tag.
Sinónimo de gene:VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:pCMV3-His-VCAM1
Local de restrição:KpnI + NotI(6kb+2.24kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with VCAM1 qPCR primers for gene expression analysis, HP100188 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10113-ACG$245
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10113-ACR$245
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10113-CF$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10113-CH$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10113-CM$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10113-CY$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10113-M$75
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10113-M-N$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10113-NF$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10113-NH$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10113-NM$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10113-NY$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10113-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referências
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Catálogo: HG10113-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"