Encomenda rápida

Humano CCL16 / HCC-4 / NCC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano CCL16 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_004590.2
    Tamanho de cDNA:363bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 16 with C terminal HA tag.
    Sinónimo de gene:LEC, LMC, NCC4, CKb12, HCC-4, LCC-1, Mtn-1, NCC-4, SCYL4, ILINCK, SCYA16, MGC117051, CCL16
    Espécie:Human
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCL16 qPCR primers for gene expression analysis, HP100512 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano CCL16 / HCC-4 / NCC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Product nameProduct name
    Fundo

    CCL16, a chemokine poorly characterized at the functional level. Human CCL16 is a member of the CC family, and its gene maps to human chromosome 17q. In the mouse, only a pseudogene has been identified to date. CCL16 is a functional ligand for CCR1, CCR2, CCR5, and CCR8. Recombinant CCL16 demonstrated chemotactic activity on human monocytes and lymphocytes. Based on the ability of human chemokines to exert activity on and bind to murine receptors, the TSA mouse adenocarcinoma cell line was transfected with human CCL16 cDNA and, in comparison with other cytokines, was shown to be the faster inducer of systemic immune response due to massive, prompt infiltration of leukocytes.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referências
  • Guiducci C, Di Carlo E, Parenza M, et al. Intralesional injection of adenovirus encoding CC chemokine ligand 16 inhibits mammary tumor growth and prevents metastatic-induced death after surgical removal of the treated primary tumor[J]. The Journal of Immunology, 2004, 172(7): 4026-4036.
  • Size / Price
    Catálogo: HG10491-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"