After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CAT Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001752.3
Tamanho de cDNA:1584bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens catalase with N terminal Flag tag.
Sinónimo de gene:MGC138422, MGC138424, CAT
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1206C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12084-ACG$245
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12084-ACR$245
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12084-ANG$245
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12084-ANR$245
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12084-CF$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12084-CH$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12084-CM$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12084-CY$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de expressão)HG12084-G$75
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12084-G-N$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12084-NF$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12084-NH$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12084-NM$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12084-NY$215
Humano CAT/Catalase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12084-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

Referências
  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Catálogo: HG12084-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"