After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CAPG Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC014549
Tamanho de cDNA:1047bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
Sinónimo de gene:AFCP, MCP, CAPG
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14213-ACG$225
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14213-ACR$225
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14213-ANG$225
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14213-ANR$225
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14213-CF$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14213-CH$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14213-CM$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14213-CY$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de expressão)HG14213-G$75
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14213-NF$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14213-NH$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14213-NM$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14213-NY$195
Humano CAPG / AFCP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14213-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

Referências
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Catálogo: HG14213-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"