Encomenda rápida

Text Size:AAA

Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CAMK2G Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1557bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with C terminal His tag.
Sinónimo de gene:CAMK, CAMKG, CAMK-II, FLJ16043, MGC26678, CAMK2G
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11125-ACG$245
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11125-ACR$245
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11125-ANG$245
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11125-ANR$245
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11125-CF$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11125-CH$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11125-CM$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11125-CY$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11125-M$75
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11125-M-F$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11125-NF$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11125-NH$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11125-NM$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11125-NY$215
Humano CaMKII/CAMK2G transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11125-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11125-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.