Encomenda rápida

Text Size:AAA

Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CALCB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000728.3
Tamanho de cDNA:384bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens calcitonin-related polypeptide beta.
Sinónimo de gene:CALC2, CGRP2, CGRP-II, CALCB
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13283-ACG$225
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13283-ACR$225
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13283-CF$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13283-CH$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13283-CM$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13283-CY$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG13283-G$75
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13283-NF$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13283-NH$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13283-NM$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13283-NY$195
Humano CALCB / CGPR / Calcitonin 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13283-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT) peptide which may play a role in the mediation of human inflammatory diseases. It is highly expressed in the skin, blood, and cerebrospinal fluid. CGRP immunolabeling (IL) was detected in epidermal keratinocytes at levels that were especially high and widespread in the skin of humans from locations afflicted with postherpetic neuralgia (PHN) and complex region pain syndrome type 1 (CRPS), of monkeys infected with simian immunodeficiency virus, and of rats subjected to L5/L6 spinal nerve ligation, sciatic nerve chronic constriction, and subcutaneous injection of complete Freund's adjuvant. Increased CGRP-IL was also detected in epidermal keratinocytes of transgenic mice with keratin-14 promoter driven overexpression of noggin, an antagonist to BMP-4 signaling. CGPR dilates a variety of vessels including the coronary, cerebral and systemic vasculature.

Referências
  • Lambert NA. 2008, Sci Signal. 1 (25): re5.
  • Linscheid P. et al., 2005, Endocrinology. 146 (6): 2699-708.
  • Hou Q. et al., 2011, Pain. 152 (9): 2036-51.
  • Size / Price
    Catálogo: HG13283-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade4-5 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"