Encomenda rápida

Text Size:AAA

Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CA13 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:789bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase XIII with C terminal His tag.
Sinónimo de gene:CAXIII, FLJ37995, MGC59868, CA13
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10461-ACG$225
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10461-ACR$225
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10461-ANG$225
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10461-ANR$225
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10461-CF$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10461-CH$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10461-CM$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10461-CY$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10461-M$75
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10461-M-F$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10461-NF$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10461-NH$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10461-NM$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10461-NY$195
Humano Carbonic Anhydrase XIII/CA13 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10461-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Size / Price
    Catálogo: HG10461-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.