After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CA9 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001216.2
Tamanho de cDNA:1380bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase IX with N terminal His tag.
Sinónimo de gene:CA9, MN, CAIX
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10107-ACG$225
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10107-ACR$225
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10107-ANG$225
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10107-ANR$225
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10107-CF$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10107-CH$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10107-CM$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10107-CY$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10107-M$75
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10107-NF$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10107-NH$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10107-NM$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10107-NY$195
Humano Carbonic Anhydrase IX/CA9 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10107-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

Referências
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Size / Price
    Catálogo: HG10107-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"