Encomenda rápida

Text Size:AAA

Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CA2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:783bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens carbonic anhydrase II with C terminal HA tag.
Sinónimo de gene:CAII, Car2, CA-II, CA2
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10478-ACG$225
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10478-ACR$225
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10478-ANG$225
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10478-ANR$225
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10478-CF$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10478-CH$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10478-CM$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10478-CM$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10478-CY$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de expressão)HG10478-M$75
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10478-NF$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10478-NH$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10478-NM$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10478-NY$195
Humano Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10478-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catálogo: HG10478-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.