Encomenda rápida

Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human C11ORF82 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2997bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens chromosome 11 open reading frame 82 with C terminal His tag.
Sinónimo de gene:noxin, C11orf82
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13383-ACG$325
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13383-ACR$325
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13383-ANG$325
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13383-ANR$325
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13383-CF$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13383-CH$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13383-CM$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13383-CY$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de expressão)HG13383-G$75
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13383-NF$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13383-NH$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13383-NM$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13383-NY$295
Humano C11ORF82 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13383-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG13383-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.