Encomenda rápida

Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human BTK Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1980bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with C terminal Myc tag.
Sinónimo de gene:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Local de restrição:KpnI + NotI (6kb + 2.03kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human BTK Gene Plasmid Map
Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10578-ACG$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10578-ACR$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10578-ANG$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10578-ANR$245
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10578-CF$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10578-CH$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10578-CM$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10578-CY$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de expressão)HG10578-M$75
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10578-NF$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10578-NH$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10578-NM$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10578-NY$215
Humano Bruton Tyrosine Kinase / BTK Kinase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10578-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.