BUB3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11236-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All BUB3 Reagents

CRO Services

Product recommended


All BUB3 Reagents

BUB3 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
987 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human POT1 protection of telomeres 1 homolog with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI (6kb + 1.03kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BUB3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BUB3 cDNA ORF Clone, Human, C-Myc tag Validated Images

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5621

BUB3 cDNA ORF Clone, Human, C-Myc tag Alternative Names

BUB3L cDNA ORF Clone, Human;hBUB3 cDNA ORF Clone, Human

BUB3 Background Information

Full Name
BUB3 mitotic checkpoint protein

BUB3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
BUB3 cDNA ORF Clone in Cloning Vector, Ferret FG60153-G
BUB3 cDNA ORF Clone, Ferret, untagged FG60153-UT
BUB3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60153-ACGLN
BUB3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60153-ACG
BUB3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60153-ANG
BUB3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60153-ACR
BUB3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60153-ANR
BUB3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60153-CF
BUB3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60153-NF
BUB3 cDNA ORF Clone, Ferret, C-His tag FG60153-CH
BUB3 cDNA ORF Clone, Ferret, N-His tag FG60153-NH
BUB3 cDNA ORF Clone, Ferret, C-HA tag FG60153-CY
BUB3 cDNA ORF Clone, Ferret, N-HA tag FG60153-NY
BUB3 cDNA ORF Clone, Ferret, C-Myc tag FG60153-CM
BUB3 cDNA ORF Clone, Ferret, N-Myc tag FG60153-NM

BUB3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BUB3 cDNA ORF Clone in Cloning Vector, Human HG11236-M
BUB3 cDNA ORF Clone, Human, untagged HG11236-UT
BUB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11236-ACGLN
BUB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11236-ACG
BUB3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11236-ANG
BUB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11236-ACR
BUB3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11236-ANR
BUB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11236-CF
BUB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11236-NF
BUB3 cDNA ORF Clone, Human, C-His tag HG11236-CH
BUB3 cDNA ORF Clone, Human, N-His tag HG11236-NH
BUB3 cDNA ORF Clone, Human, C-HA tag HG11236-CY
BUB3 cDNA ORF Clone, Human, N-HA tag HG11236-NY
BUB3 cDNA ORF Clone, Human, N-Myc tag HG11236-NM
BUB3 qPCR Primer Pairs, Human HP101180
info info
添加购物车成功! 添加购物车失败!