Encomenda rápida

Text Size:AAA

Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human BRIX1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1062bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) with N terminal His tag.
Sinónimo de gene:BRIX, BXDC2, FLJ11100, BRIX1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11391-ACG$225
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11391-ACR$225
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11391-ANG$225
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11391-ANR$225
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11391-CF$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11391-CH$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11391-CM$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11391-CY$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11391-M$75
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11391-NF$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11391-NH$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11391-NM$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11391-NY$195
Humano BRIX1/BXDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11391-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11391-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.