Encomenda rápida

Humano B Raf clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

  • Human STAT3 Gene Plasmid Map 5680
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano BRAF Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004333.4
Tamanho de cDNA:2340 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens v-raf murine sarcoma viral oncogene homolog B1 with C terminal Flag tag.
Sinónimo de gene:BRAF1, RAFB1, B-RAF1, FLJ95109, MGC126806, MGC138284
Espécie:Human
Vetor:pCMV3-C-FLAG
Plasmid:pCMV3-BRAF-Flag
Local de restrição:HindIII + NotI(6kb+2.34kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BRAF qPCR primers for gene expression analysis, HP101484 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fundo

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referências
  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.
  • Size / Price
    Catálogo: HG11632-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"