After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano BPHL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human BPHL Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC106901
Tamanho de cDNA:825bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal HA tag.
Sinónimo de gene:MCNAA, BPH-RP, VACVASE
Espécie:Human
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fundo

BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

Referências
  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Catálogo: HG15763-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"