Encomenda rápida

Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano BIN2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC047686
Tamanho de cDNA:1698bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens bridging integrator 2 DNA.
Sinónimo de gene:BRAP-1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BIN2 qPCR primers for gene expression analysis, HP103852 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15226-ACG$245
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15226-ACR$245
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15226-ANG$245
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15226-ANR$245
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15226-CF$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15226-CH$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15226-CM$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15226-CY$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15226-G$75
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15226-NF$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15226-NH$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15226-NM$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15226-NY$215
Humano BIN2 / BRAP-1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15226-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15226-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"