Encomenda rápida

Text Size:AAA

Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ANGPTL4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1221bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens angiopoietin-like 4, transcript variant 1 with N terminal Flag tag.
Sinónimo de gene:NL2, ARP4, FIAF, PGAR, HFARP, pp1158, ANGPTL2
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10563-ACG$225
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10563-ACR$225
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10563-CF$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10563-CH$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10563-CM$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10563-CY$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10563-M$75
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10563-M-F$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10563-NF$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10563-NH$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10563-NM$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10563-NY$195
Humano ANGPTL4 / angiopoietin-like Proteína 4 transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10563-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catálogo: HG10563-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.