Angiogenin cDNA ORF Clone, Human, C-His tag

Cat: HG10441-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Angiogenin Reagents
CRO Services
Product recommended

All Angiogenin Reagents
Angiogenin cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
489 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiogenin, ribonuclease, RNase A family, 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+0.49kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Angiogenin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiogenin cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
Angiogenin cDNA ORF Clone, Human, C-His tag Alternative Names
ALS9 cDNA ORF Clone, Human;HEL168 cDNA ORF Clone, Human;RAA1 cDNA ORF Clone, Human;RNASE4 cDNA ORF Clone, Human;RNASE5 cDNA ORF Clone, Human
Angiogenin Background Information
Full Name
angiogenin, ribonuclease, RNase A family, 5

Angiogenin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Angiogenin cDNA ORF Clone in Cloning Vector, Mouse MG58280-U
Angiogenin cDNA ORF Clone, Mouse, untagged MG58280-UT
Angiogenin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58280-ACG
Angiogenin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58280-ACGLN
Angiogenin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58280-ACR
Angiogenin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58280-CF
Angiogenin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58280-NF
Angiogenin cDNA ORF Clone, Mouse, C-His tag MG58280-CH
Angiogenin cDNA ORF Clone, Mouse, N-His tag MG58280-NH
Angiogenin cDNA ORF Clone, Mouse, C-HA tag MG58280-CY
Angiogenin cDNA ORF Clone, Mouse, N-HA tag MG58280-NY
Angiogenin cDNA ORF Clone, Mouse, C-Myc tag MG58280-CM
Angiogenin cDNA ORF Clone, Mouse, N-Myc tag MG58280-NM

Angiogenin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Angiogenin cDNA ORF Clone in Cloning Vector, Human HG10441-M
Angiogenin cDNA ORF Clone, Human, untagged HG10441-UT
Angiogenin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10441-ACGLN
Angiogenin cDNA ORF Clone, Human, C-GFPSpark® tag HG10441-ACG
Angiogenin cDNA ORF Clone, Human, C-OFPSpark® tag HG10441-ACR
Angiogenin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10441-CF
Angiogenin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10441-NF
Angiogenin cDNA ORF Clone, Human, N-His tag HG10441-NH
Angiogenin cDNA ORF Clone, Human, C-HA tag HG10441-CY
Angiogenin cDNA ORF Clone, Human, N-HA tag HG10441-NY
Angiogenin cDNA ORF Clone, Human, C-Myc tag HG10441-CM
Angiogenin cDNA ORF Clone, Human, N-Myc tag HG10441-NM
Angiogenin qPCR Primer Pairs, Human HP100470
info info
添加购物车成功! 添加购物车失败!