After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ATF4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_182810.1
Tamanho de cDNA:1056bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens activating transcription factor 4 (tax-responsive enhancer element B67) with C terminal His tag.
Sinónimo de gene:CREB2, TXREB, CREB-2, TAXREB67, ATF4
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11124-ACG$225
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11124-ACR$225
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11124-ANG$225
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11124-ANR$225
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11124-CF$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11124-CH$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11124-CM$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11124-CY$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11124-M$75
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11124-M-F$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11124-NF$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11124-NH$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11124-NM$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11124-NY$195
Humano ATF-4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11124-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11124-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"