Encomenda rápida

Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano ASPH Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC066929
    Tamanho de cDNA:612bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens aspartate beta-hydroxylase with C terminal His tag.
    Sinónimo de gene:AAH, BAH, HAAH, JCTN, junctin, CASQ2BP1
    Espécie:Human
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ASPH qPCR primers for gene expression analysis, HP103780 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15153-ACG$225
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15153-ACR$225
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15153-ANG$225
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15153-ANR$225
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15153-CF$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15153-CH$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15153-CM$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15153-CY$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de expressão)HG15153-G$75
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15153-NF$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15153-NH$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15153-NM$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15153-NY$195
    Humano ASPH/Aspartate beta hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15153-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG15153-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"