Encomenda rápida

Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ARSA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1524bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens arylsulfatase A with C terminal His tag.
Sinónimo de gene:MLD, ARSA
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10449-ACG$245
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10449-ACR$245
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10449-CF$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10449-CH$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10449-CM$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10449-CY$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de expressão)HG10449-M$75
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10449-M-F$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10449-M-N$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10449-NF$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10449-NH$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10449-NM$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10449-NY$215
Humano Arylsulfatase A / ARSA clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10449-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • Size / Price
    Catálogo: HG10449-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.