Encomenda rápida

Text Size:AAA

Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human APPL1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2130bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 with C terminal His tag.
Sinónimo de gene:APPL, DIP13alpha, APPL1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11119-ACG$245
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11119-ACR$245
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11119-ANG$245
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11119-ANR$245
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11119-CF$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11119-CH$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11119-CM$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11119-CY$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de expressão)HG11119-M$75
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11119-NF$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11119-NH$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11119-NM$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11119-NY$215
Humano APPL1/APPL clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11119-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG11119-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.