Encomenda rápida

Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human APEX1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001641.3
Tamanho de cDNA:957bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1.
Sinónimo de gene:APE, APX, APE1, APEN, APEX, HAP1, REF1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG16161-ACG$225
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG16161-ACR$225
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG16161-ANG$225
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG16161-ANR$225
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG16161-CF$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG16161-CH$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG16161-CM$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG16161-CY$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG16161-G$75
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG16161-NF$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG16161-NH$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG16161-NM$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG16161-NY$195
Humano APEX1/APE1/Ref-1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG16161-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

Referências
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Catálogo: HG16161-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"