Encomenda rápida

Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ANXA5 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:963bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens annexin A5 with C terminal His tag.
Sinónimo de gene:PP4, ANX5, ENX2, ANXA5
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10448-ACG$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10448-ACR$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10448-ANG$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10448-ANR$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10448-CF$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10448-CH$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10448-CM$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10448-CY$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10448-M$75
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10448-M-F$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10448-M-N$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10448-NF$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10448-NH$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10448-NM$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10448-NY$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10448-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Catálogo: HG10448-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.