After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ANXA5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001154.3
Tamanho de cDNA:963bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens annexin A5 with C terminal His tag.
Sinónimo de gene:PP4, ANX5, ENX2, ANXA5
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10448-ACG$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10448-ACR$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10448-ANG$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10448-ANR$225
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10448-CF$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10448-CH$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10448-CM$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10448-CY$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10448-M$75
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10448-M-F$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10448-M-N$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10448-NF$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10448-NH$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10448-NM$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10448-NY$195
Humano ANXA5 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10448-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Referências
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Catálogo: HG10448-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"