After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ANAPC5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_016237.4
Tamanho de cDNA:2268bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens anaphase promoting complex subunit 5.
Sinónimo de gene:APC5
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14222-ACG$245
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14222-ACR$245
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14222-ANG$245
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14222-ANR$245
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14222-CF$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14222-CH$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14222-CM$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14222-CY$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14222-G$75
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14222-NF$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14222-NH$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14222-NM$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14222-NY$215
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14222-U$75
Humano Apc5/ANAPC5 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14222-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG14222-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"