After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human AMIGO2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC047595
Tamanho de cDNA:1569bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens adhesion molecule with Ig-like domain 2 with N terminal Myc tag.
Sinónimo de gene:ALI1, DEGA, AMIGO2
Espécie:Human
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13735-ACG$245
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13735-ACR$245
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13735-CF$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13735-CH$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13735-CM$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13735-CY$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG13735-G$75
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13735-NF$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13735-NH$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13735-NM$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13735-NY$215
Humano AMIGO2 / AMIGO-2 / alivin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13735-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

Referências
  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    Catálogo: HG13735-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"