ALKBH3/ABH3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15639-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ALKBH3/ABH3 Reagents

CRO Services

Product recommended


All ALKBH3/ABH3 Reagents

ALKBH3/ABH3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
861 bp
Description
Full length Clone DNA of Human alkB, alkylation repair homolog 3 (E. coli) with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALKBH3/ABH3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

ABH3 cDNA ORF Clone, Human;DEPC-1 cDNA ORF Clone, Human;DEPC1 cDNA ORF Clone, Human;PCA1 cDNA ORF Clone, Human

ALKBH3/ABH3 Background Information

Full Name
alkB, alkylation repair homolog 3 (E. coli)

ALKBH3/ABH3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ALKBH3/ABH3 cDNA ORF Clone in Cloning Vector, Rat RG81237-U
ALKBH3/ABH3 cDNA ORF Clone, Rat, untagged RG81237-UT
ALKBH3/ABH3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81237-ACGLN
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81237-ACG
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81237-ANG
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81237-ACR
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81237-ANR
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81237-CF
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81237-NF
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-His tag RG81237-CH
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-His tag RG81237-NH
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-HA tag RG81237-CY
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-HA tag RG81237-NY
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-Myc tag RG81237-CM
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-Myc tag RG81237-NM
ALKBH3/ABH3 qPCR Primer Pairs, Rat RP301193

ALKBH3/ABH3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALKBH3/ABH3 cDNA ORF Clone in Cloning Vector, Mouse MG53270-U
ALKBH3/ABH3 cDNA ORF Clone, Mouse, untagged MG53270-UT
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53270-ACG
ALKBH3/ABH3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53270-ACGLN
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53270-ANG
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53270-ACR
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53270-ANR
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53270-CF
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53270-NF
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-His tag MG53270-CH
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-His tag MG53270-NH
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-HA tag MG53270-CY
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-HA tag MG53270-NY
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-Myc tag MG53270-CM
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-Myc tag MG53270-NM

ALKBH3/ABH3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALKBH3/ABH3 cDNA ORF Clone in Cloning Vector, Human HG15639-G
ALKBH3/ABH3 cDNA ORF Clone, Human, untagged HG15639-UT
ALKBH3/ABH3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15639-ACGLN
ALKBH3/ABH3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15639-ACG
ALKBH3/ABH3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15639-ANG
ALKBH3/ABH3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15639-ACR
ALKBH3/ABH3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15639-ANR
ALKBH3/ABH3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15639-NF
ALKBH3/ABH3 cDNA ORF Clone, Human, C-His tag HG15639-CH
ALKBH3/ABH3 cDNA ORF Clone, Human, N-His tag HG15639-NH
ALKBH3/ABH3 cDNA ORF Clone, Human, C-HA tag HG15639-CY
ALKBH3/ABH3 cDNA ORF Clone, Human, N-HA tag HG15639-NY
ALKBH3/ABH3 cDNA ORF Clone, Human, C-Myc tag HG15639-CM
ALKBH3/ABH3 cDNA ORF Clone, Human, N-Myc tag HG15639-NM
ALKBH3/ABH3 qPCR Primer Pairs, Human HP104257
info info
添加购物车成功! 添加购物车失败!