After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ALK-3 / BMPR1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human BMPR1A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004329.2
Tamanho de cDNA:1599bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens bone morphogenetic protein receptor, type I A with C terminal His tag.
Sinónimo de gene:ALK3, CD292, ACVRLK3, 10q23del, BMPR1A
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano ALK-3 / BMPR1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name
Fundo

Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-β) superfamily. The BMP receptors form a subfamily of transmembrane serine/threonine kinases including the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. ALK-3/BMPR1A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. ALK-3 and ALK-6 share a high degree of homology, yet possess distinct signaling roles. The transforming growth factor (TGF)-beta type III receptor (TbetaRIII) enhanced both ALK-3 and ALK-6 signaling. TbetaRIII associated with ALK-3 primarily through their extracellular domains, whereas its interaction with ALK-6 required both the extracellular and cytoplasmic domains. ALK-3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK-3 was specifically required at mid-gestation for normal development of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK-3 was specifically deficient in expressing TGFbeta2, an established paracrine mediator of cushion morphogenesis. Hence, ALK-3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.

Referências
  • Gaussin V, et al. (2002) Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 99(5): 2878-83.
  • Eblaghie MC, et al. (2006) Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol. 291(1): 67-82.
  • Sun J, et al. (2007) Deficient Alk3-mediated BMP signaling causes prenatal omphalocele-like defect. Biochem Biophys Res Commun. 360(1): 238-43.
  • Lee NY, et al. (2009) The transforming growth factor-beta type III receptor mediates distinct subcellular trafficking and downstream signaling of activin-like kinase (ALK)3 and ALK6 receptors. Mol Biol Cell. 20(20): 4362-70.
  • Size / Price
    Catálogo: HG10446-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"