Encomenda rápida

Text Size:AAA

Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ALDH1A3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1539bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member A3 with C terminal Flag tag.
Sinónimo de gene:ALDH6, RALDH3, ALDH1A6, ALDH1A3
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1530 G/A and 1536 C/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11636-ACG$245
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11636-ACR$245
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11636-ANG$245
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11636-ANR$245
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11636-CF$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11636-CH$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11636-CM$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11636-CY$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11636-M$75
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11636-NF$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11636-NH$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11636-NM$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11636-NY$215
Humano ALDH1A3/RALDH3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11636-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the aldehyde dehydrogenase family. ALDH1A3 is a novel Cancer stem cell (CSC) marker with potential clinical prognostic applicability, and demonstrates a clear correlation between CSC prevalence and the development of metastatic breast cancer. The retinoic acid (RA) biosynthesis enzyme aldehyde dehydrogenase 1A3 (ALDH1A3) is a putative androgen-responsive gene in human prostate cancer epithelial (LNCaP) cells. The RA biosynthesis enzyme ALDH1A3 is androgen responsive and (ii) DHT up-regulation of ALDH1A3 can increase the oxidation of retinal to RA and indirectly affect RA bioactivity and metabolism.

  • Marcato P, et al. (2011) Aldehyde dehydrogenase activity of breast cancer stem cells is primarily due to isoform ALDH1A3 and its expression is predictive of metastasis. Stem Cells. 29(1)32-45.
  • Trasino SE, et al. (2007) Androgen regulation of aldehyde dehydrogenase 1A3 (ALDH1A3) in the androgen-responsive human prostate cancer cell line LNCaP. Exp Biol Med (Maywood). 232(6): 762-71.
  • Size / Price
    Catálogo: HG11636-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Human AURKB ORF mammalian expression plasmid, C-Flag tag
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.