After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human AKT1S1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:771bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal His tag.
Sinónimo de gene:AKT1S1, Lob, PRAS40, MGC2865
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10092-ACG$225
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10092-ACR$225
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10092-ANG$225
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10092-ANR$225
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10092-CF$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10092-CH$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10092-CM$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10092-CY$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10092-M$75
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10092-M-F$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10092-NF$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10092-NH$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10092-NM$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10092-NY$195
Humano AKT1S1/PRAS40 transcript variant 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10092-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10092-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.