Encomenda rápida

Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human AK4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC016180
Tamanho de cDNA:672bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens adenylate kinase 4 with N terminal His tag.
Sinónimo de gene:AK3, AK3L1, AK3L2
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12406-ACG$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12406-ACR$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12406-ANG$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12406-ANR$225
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12406-CF$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12406-CH$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12406-CM$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12406-CY$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12406-G$75
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12406-NF$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12406-NH$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12406-NM$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12406-NY$195
Humano AK4 / Adenylate Kinase 4 / AK3L1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12406-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Catálogo: HG12406-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"